padding-bottom:6px;

Sunday Blog: Five lists of 5 including Quinn

Commentary by Tracy McCue, Sumner Newscow — Five lists of five for Aug. 24, 2014…

 

1. Five things that probably should go away soon…

Ice bucket challenge sweeps WellingtonIce Bucket Water Challenge – Yes, it goes without saying pouring ice water over one’s head is extremely funny and goes to a great cause, but after viewing 2,426,213 videos on Facebook and this site, it’s time to move on to something else.

Ferguson Mo. – I’m sure there are lessons to be learned here, but I can’t help but think if CNN and Fox News wasn’t there, rioting would have ended long ago.

Go away!

Go away!

Detroit Tigers – They are standing in the way of the Kansas City Royals making their first playoff performance in 30 years. It’s almost September and football is about to start, and yet I find myself nervous about baseball.

The summer heat – Oh, I shouldn’t complain because it has been a cool summer. But the 100 degree days which hit this week simultaneously with the start of the fall sports season has been a true bummer.

ISIS – Oh, them. International terrorism appears to be on the upswing. It just feels like something bad is going to happen soon. Maybe we are paying enough attention to prevent another 911 this time.

2. Five things that made Max Bretches cool…

Max Bretches

Max Bretches

2a. The former Wellington High School athletic director who died Monday was one of those guys you instantly liked. You don’t know why but you did.

 

2b. He helped form the district high school football playoff system we have today. Before that the KSHSAA had a convoluted point system that screwed out a many 1970s teams that should have made the playoffs including a few WHS football squads.

 

2c. His golf teams rocked. One source has told me on numerous occasions that the state championship golf team of 1983 was pretty good.

 

2d. Nobody kept us laughing at Crusader Club luncheons like Max. The fact he was a regular long after his retirement showed how much he cared about Crusader athletes.

 

2e. Did anyone in town have a cleaner pickup?

 

 

3. My five favorite songs as I approach 50…

Walter White liked this song as well.

Walter White liked this song as well.

3a. Crystal Blue Persuasion by Tommy James & The Shondells – This song was written in 1969 but wasn’t on my radar until I heard it on the TV Show Breaking Bad. Now I can’t get enough of it.

 

3b. Owner of a Lonely Heart by Yes – This song was popular during my hormonal 1980s decade and it still kicks tail today.

 

3c. Free by Zac Brown Band – I usually have to fight off tears when this song gets played.

 

3d. Walk on the Wild Side by Lou Reed – Who says today’s songs are so much more perverted? That saxophone solo at the end may be the best non-guitar riff in rock music history.

 

3e. More than a Feeling by Boston – Really when you get down to it, Boston owned the 1970s and this song was the best the group sung.

 

4. Five stupid sports cliches…

4a. “Give it your 110 percent effort.” That’s impossible. In order to do that you would somehow have to borrow 10 percent effort from someone else whether telepathically, osmosis or something that can transport physicality. And if you were able to transport someone’s effort to yourself, wouldn’t you still be submitting 100 percent effort for yourself?

 

4b. “We are going to take one game at a time.” Well, yeah. But can you do it any other way? I guess you can schedule Augusta and Mulvane on the same night on two separate fields playing at the same time and run back and forth from say Sellers Park to 9th Street. But it doesn’t seem practical. Really, is there any sport where we play two games at once except for bingo and fantasy football?

 

4c. “These players have heart.” Yes, they do coach and they also have lungs and brains and toes and things that can make them reproduce.

 

4d. “We are No. 1!” No. 1 on the field at that very second? No. 1 in the polls? No. 1 in life? No. 1 in getting out of the locker room fast enough? No. 1 in detentions? I’m confused, elaborate!

"And one last thing coach. Win one for the National Republican Party!"

“And one last thing coach. Win one for the National Republican Party!”

 

4e. “Go out there and win one for the Gipper.” I loved Ronald Reagan but when his character uttered that line in that old movie before dying I wanted to punch him. What if the team didn’t win? Is the Gipper really going to saddle those players with guilt for the rest of their lives? When I’m on my deathbed, I promise to not utter “Win one for the Cueball,” – unless you are from Andale or on a team with Peyton Manning.

 

5. Here’s Quinn…

 

Quinn McCue

Quinn McCue

1.Should I write a book? I have some ideas. Would you read it?

 

2.First week of school, it’s great to be back. Although I will miss just sitting in my room with a fruit cup in my hands.

 

3. Oh how I love to code messages in DNA sequence.

 

4.I’ve been working on the difference of an analogy and metaphor for 4 months and I still don’t know the difference.

 

5.CTAGGATACGCTTTGTTTTGAAACAGCAAAATATAAGTATACGTATTGGCGGCATCTTTTT
GAAACAGCAAAATCTTGTCTTAGTTGTAAGCGGCGTGAGGATCATTGGCATCTTTGGGGTAAGCAGTAGTTTTTAACATGGCGTAGTAATT
GGGCTAGTCCTTGGCATTGGGCTCCGGAGGATTGTCTTTTAACATCTCGGGTGTATCCTCT

Follow us on Twitter.

 

Powered by WordPress